Ubi Taq Polymerase

Transgenically Enhanced Sorbitol Synthesis Facilitates Phloem …
Struct called Ubi-S6PDH was electroporated into Agrob-acterium strain EHA 105 and was used for transform- mately 50 ng of template DNA, 5 U Taq polymerase in a buffer of 50 mM KCl, 10 mM Tris-HCl, 2 mM MgCl … Return Doc

Genetic Engineering Of Maize For Drought Tolerance Paper For …
In Ubi/NC1300 vector. The amiRNA expression cassette was then removed as an HindIII/ through PCR using high fidelity Taq polymerase. The fragment was then ligated into … Read Here

Use Of Chromatin Immunoprecipitation To Clone Novel E2F …
Antibodies used included E2F1 no. 05-379 (UBI), E2F2 C-20 no. SC-633X (Santa Cruz), E2F3 C-18 no. SC-878X (Santa Cruz), E2F4 C-20 no. SC-866X dCTP, dGTP, and dTTP; 1 thermophilic buffer (Promega); and 1.25 U of Taq DNA polymerase (Promega) in a total volume of 20 l. … Access Document

JunB Gene Expression Is Inactivated By Methylation In Chronic …
Significant effects in Ubi-junB transgenic mice.14 JunB has also and reverse primers and Taq Man probe were designed using Primer Express 1.5 mM MgCl2,2UofTaq DNA polymerase (Promega), and 1 PCR … Fetch Document

Some Implications Of Molecular Phylogenetics For …
PCR using Taq Polymerase (Perkin Elmer), and MJ Research MiniCyclers or Perkin Elmer Gene- sp. 1/UBI Australia (Perth, Queensland, Sydney), Japan (Miyazu Bay, Sakata Bay), USA (Long Beach, Marina del Rey) … Return Document

Molecular Breeding 4: 99–109, 1998. 99
Under the control of the Ubi-1 promoter-exon-intron (kindly supplied by Dr J. Tipperman). 12or15ofTable1),0.5U of Taq Polymerase(Perkin Elmer, USA), the thermal profile was that specified in … Access Doc

Transgenic Sorghum ( Sorghum Bicolor L. Moench Developed By …
The transformation vector contains ubi 1 promoter, harcho and T nos terminator gene 2, 1x PCR buffer; 1 U Taq-polymerase and 50 ng plasmid DNA. Southern blotting was carried … Get Document

A polymerase Chain Reaction Based Study On The Subclinical …
U Taq DNA polymerase, 0.4 mM dNTPs, 50 pmol of each primer, 5 µl of 10× PCR buffer S. uberis STRU-UbI STRU-UbII TAAGGAACACGTTGGTTAAG TCCAGTCCTTAGACCTTCT 1.5 330 … Retrieve Document

THE PREVALENCE OF VIRAL HEPATITIS AMONG THE HMONG PEOPLE OF …
(Abbott, Europe; UBI, USA respectively). The EIA method for anti-HAV, anti-HCV and anti- , 0.5 µl of 5 U/µl Taq DNA polymerase (Promega, USA) and deionized water to give … View Doc

JUNIPERUS ZANONII, A NEW SPECIES FROM CERRO POTOSI, NUEVO …
DNA, 1.5 units Epi-Centre Fail-Safe Taq polymerase, 15 µl 2x buffer E (petN-psbM) or K (nrDNA) (final concentration: 50 mM KCl, 50 mM squamatis saepe porcatis glandibus ubi manifestis complanatis vel elevatis ovalibus, et foliis flagelliformibus glandibus elevatis ovalibus … Fetch Content