Taq Polymerase Eurobio

Evidence For The Origin Of The B Genome Of Bread Wheat Based …
And Taq polymerase (5 U μL-1, Eurobio). DNA was added to each PCR reaction at a rate of 20 ng and the total volume was adjusted with double-distilled H … Read Document

Hal.inria.fr
GGCGTTGCCGCTCTGAATTGC) and HTTLPRR (GAGGGACTGAGCTGGACAACCCAC) in reaction mixtures with a total volume of 25 l, with 200 ng of genomic DNA, 10 pM of the primers, 120 nM dNTP, containing μ 7-deaza-dGTP instead of dGTP (Roche), 5 DMSO (Sigma), 1.5 mM MgCl , and 1.25 U Taq polymerase (Eurobio … Doc Viewer

Mining The Genetic Diversity Of Ehrlichia Ruminantium Using Map
5U/ml Taq polymerase (EurobioTaq ADN polymerase, Eurobio) and 1ml of DNA. Reactions conditions were as follows:initialdenaturation3minat958C,followedby35 … Fetch Full Source

Genetic Analysis Reveals Different Functions For The Products …
Sis, single-stranded DNA probes were generated by a 30-cycle reaction using Taq DNA polymerase from Eurobio using 10 ng of TRa (exon 8), growth hormone … Content Retrieval

Efficient Mother-to-Child Transfer Of Antiretroviral …
Units of Taq I polymerase (Eurobio, Paris, France). Forty-five cycles (94°C for 3 min, 65°C for 45 s, and 72°C for 45 s) for Env and 25 for -actin were followed … Get Content Here

Microbial Population Changes During Bioremediation Of …
F, 20mM and M13 R, 20mM) and 0.5ml of Taq polymerase (Eurobio). Milli-Q water was added until to reach a final volume of 25ml. The PCR temperature cycle was performed using a PTC 200 apparatus (MJ … Read Content

Nested PCR And New Primers For Analysis Of Sulfate-Reducing …
, 0.2 M each primer, 2.5 U of Taq DNA polymerase (Eurobio), and DNA template (between 0.5 to 5 ng for Carnoule`s samples and 1 to 100 ng for Berre samples) in a final volume of 50 l. … Get Content Here

Quantification Of C-erb B-2 Gene Expression In Breast Cancer …
Primers, 2 units of Taq DNA polymerase (Eurobio, Les Ulis, France), and various concentrations of IS DNA (250–1.25 amol/L). The PCR was performed as follows: … Fetch Document

Use Of Molecular Beacon For The Detection Of Fertile Male …
Ng/µl), 5 µl 10 × buffer (Eurobio), 1.5 µl 50 mM MgCl 2 (Eurobio), 5 µl primer 221 (10 pmol/µl), 5 µl primer 327 (10 pmol/µl), 5 µl molecular beacon MB-FS (10 µM synthesized by Eurogentec), 5 µl dNTPs (1 mM each), 0.5 µl Taq polymerase (5 U/µl, … Fetch This Document

HAS-1 Genetic Polymorphism In Sporadic Abdominal Aortic Aneurysm
And 1 U of Taq polymerase (Eurobio-Labtek, FR). Primers of our own design were used: 5’-GGGTTAAGGATCCGCACG-3’ (wild type allele), 5’-GGGTTAAGGATCCGCACA-3’ … Retrieve Here