Supertherm Taq Polymerase

A New Ophiostoma Species From Loblolly Pine Roots In The …
Primer, 2.5 U Taq polymerase (SuperTherm; JMR Hold-ings) and 4 μL of genomic DNA. Amplification success was assessed on a 1% (w/v) agarose gel stained with … Access Doc

Micromonospora Tulbaghiae Sp. Nov., Isolated From The Leaves …
Each reaction contained 4 mM MgCl 2, 0.1 U SuperTherm Taq polymerase (JMR Holdings), 150 mMofeachdNTP, 0.5 mM of each primer and 500–1000 ng template DNA. … View This Document

Differences In Mitochondrial DNA And Fertility Of Crosses …
200 µM dNTPs, 15 pmol of each PCR primer, 1 unit of SuperTherm Gold Taq DNA polymerase and 1 µl of genomic DNA. PCR was performed using a Perkin Elmer GeneAmp … Fetch Doc

Primers For The Amplification Of Sequence-characterized Loci
Each 25-µ L PCR reaction contained 1 ng/ µ L genomic DNA, 10 m m MgCl 2, 2.5 m m of each dNTP, 1 × PCR buffer (Southern Cross Biotechnology), 0.8 m 2-pyrrolidinone (Chakrabarti and Schutt 2001), 40 m m of each primer, and 1 U SuperTherm Taq Polymerase (Southern Cross Biotechnology). … Access Full Source

Doi:10.1093/nar/gni183 Enhancing The Efficiency Of A PCR …
polymerase, Supertherm Taq (LPI, UK) or YEA Taq (Yeasterm Biotech Co. Ltd, Taiwan), 2 ml of DNA template and 2 mlof gold colloid solution. The total volume of the solution used in … Read More

Genetic Characterization Of The Indigenous Landim And Pafuri …
2, 1.25 U Supertherm Gold Taq polymerase (Southern Cross Biotechnology ©), 1x buffer, approximately 50 pmol/ L of each primer (varying for specific … Access Doc

CHAPTER 4 POPULATION DYNAMICS OF V. CHOLERAE IN THE VAAL …
801), 1X Reaction Buffer (JMR801), 1µM of each of the primers (Table 8) and 1 unit Taq DNA polymerase (SuperTherm Taq, JMR 801). The reaction was made up to 20µL … Retrieve Here

Distribution Of Staphylococcal Cassette Chromosome Mec …
Buffer (JMR Holdings), 1.25 U Taq polymerase DNA (SuperTherm; JMR Holdings), 200 mM dNTPs (ABgene), 10 pmol each of primers CIF2 F2 and CIF2 R2, 6 pmol each of primers KDP F1 and KDP R1, … Read More

Chp1Header
Polymerase chain reactions were carried out in 25 l reactions consisting of 1 x PCR buffer, 2.5 mM MgCl 2, 2 mM of each DNTP, 5 M of each primer (T3: 5’ ATTAACCCTCACTAAAGGGA 3’, T7: 5’ TAATACGACTCACTATAGGG 3’) and 0.3 U of Supertherm Taq polymerase (Southern Cross … Fetch Content

Full Length Research Paper – Bioflocculant Production By …
MgCl 2 , 2 U Supertherm Taq polymerase, 150 mM of each dNTP, 0.5 mM of each primer (F1: 59-AGAGTTTGATCITGGCTCAG-39; I = inosine and primer R5: 59-ACGGITACCTTGTTACGACTT-39) and 2 ml template DNA. … Retrieve Document