Super Taq Polymerase Ambion

Lndependent Genetic Control Of Maize Starch-Branching Enzymes …
RT-PCR amplifications were performed using the Super- SCRIPT system (GIBCO-BRL) and Taq polymerase (Pro- from a marker template (Century, Ambion) with maximal biotin-14-CTP concentration. … Return Document

Analysis Of One-Step And Two- Step Real-Time RT-PCR Using …
Real-time reverse transcription polymerase chain reaction (RT-PCR) is a commonly used technique to analyze gene expres- utilize Platinum Taq which is a hot-start enzyme for increased specificity. … Retrieve Full Source

Supporting Information
Contaminant genomic DNA was eliminated with TURBODNA-free kit (Ambion). Reverse transcription was carried out using 1 μgoftreated RNA using 50 End-point PCR was realized in a volume of 25 μLcontaining 200 mM of eachdNTP, 0.5 μMofprimer,1 unit of Super Taq DNA polymerase (ATGC biotechnologie), and1×PCR … Fetch This Document

Identification Of Isoforms Of A Mitotic Motor In Mammalian …
Motors of the kinesin and dynein super-families have been localized to microtubule structures in reactions were preheated to 958C for 5 min, and 2.5 U Taq polymerase (Gibco-BRL) added as the reaction the Poly(A)Pure Kit from Ambion (Austin, TX) and sepa- … Get Document

Targeted Genome Modification In Mice Using Zinc-Finger Nucleases
And poly(A) tailing kit (Ambion, Austin, TX). The poly(A) AccuPrime Taq polymerase high fidelity (Invitrogen), and and RT-R (59- GATAAGGAGAAAAGCTGCACC), using Super-Script III one-step RT–PCR system with platinum Taq high … Fetch Full Source

Expression Of Chemokines, MIP-1alpha And RANTES In Caprine …
Abstract: Chemokines belong to a super family of inducible and secreted, pro-inflammatory (Ambion Inc, Austin, TX). The PCR reaction contained 1 X reaction buffer (10 mM Tris-HCl, pH 8.3, (5'TGGTGTCGCTTAGGGACTTG3') and 1.5 units of Taq polymerase in a total volume of 50 µl. … Access Content

An Ana Lysis Of Quanti Tative P CR Re Liability Throu Gh Repl …
Free water from Ambion # AM9937. The following thermo-cycling program was used. The remaining 7.105 mL of super-mix was then split equally four ways into 2 mL cryostat TAQ Polymerase Pre-Wear Assay The PCR supermix was prepared as described above, but … Get Document

Rapid Genome
(Ambion, Austin, TX, USA) with 1× Turbo DNA-free Instead of the Taq polymerase recommended in the kit, we used 1.25 U of AmpliTaq Gold In the cell culture super-natant analysis by the RDV method, the specimen exhibit- … Return Document

Genetic Analysis Reveals Population Structure And Recent …
Of faeces in RNALater (Ambion) solution at an approximately 1:7 ratio. DNA in each sample using real-time polymerase chain l reactions consisting of 1.25x Super-Taq buffer (HT Biotechnology), an additional 0.8 m … Read Full Source

TaqMan – Wikipedia, The Free Encyclopedia
The TaqMan probe principle relies on the 5´–3´ exonuclease activity of Taq polymerase to cleave a dual-labeled probe during hybridization to the complementary target sequence and fluorophore-based detection. As in other real-time PCR methods, the resulting fluorescence signal permits quantitative … Read Article

REPRODUCTION
Queous-4PCR kit (Ambion) and subsequently treated with DNase 1 (Ambion) to remove any contaminating DNA. tion products from step 1, 1 U DNA polymerase (Super-Taq-polymerase enzyme; Sigma, Poole, Dorset, UK) … Access Content