Proofreading Taq Polymerase Invitrogen

Five-minute Cloning Of Taq polymerase-amplified PCR Products …
Www.invitrogen.com tech_service@invitrogen.com If you wish to use a mixture containing Taq polymerase and a proofreading polymerase (i.e. Expand ™ or eLONGase ), Taq must be used in excess of a 10:1 … Read Here

Direct Your Cloning Future. Cloning Technology
Whether you’re PCR cloning with Taq DNA polymerase or a proofreading enzyme, there is a TOPO® Licenses (See the Invitrogen catalog or our web site, www.invitrogen.com). By the use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Taq DNA polymerase … Visit Document

Taq Polimerasa – Viquipèdia
Aquest enzim és molt termoestable i té activitat de proofreading del ADN, per tant, es la taxa d'error és molt més baixa. Són diversos els proveidors comercials de Taq ADN Polimerases, incloent Invitrogen, Applied Biosystems, Sigma, Promega, Roche Diagnostics, Qiagen, AttendBio, Bioneer i Fermentas. … Read Article

PCR Enzyme Overview
Platinum® Taq DNA Polymerase is also available in AccuPrime™ products, which con-tain accessory protein components that give you specific primer-template hybridization in every cycle of PCR. High-Fidelity PCR Invitrogen’s PCR enzyme blends containing a proofreading enzyme … Visit Document

AccuPrime™ Pfx DNA Polymerase
Containing recombinant DNA polymerase from Thermococcus species strain KOD (1,2). This polymerase possesses a proofreading 3™ to 5™ exonuclease Use Label License No. 134: AccuPrimeŽ ŽTaq and Limited Use Label License No. 136: Pfx DNA Polymerase This product is manufactured for Invitrogen by … Fetch This Document

TA Cloning Kit – The Museum Of Vertebrate Zoology At Berkeley
If you wish to use a mixture containing Taq polymerase and a proofreading polymerase, Taq must be in excess of a 10:1 ratio to ensure the presence of 3’ A-overhangs on the PCR product. We recommend using Platinum® Taq DNA Polymerase High Fidelity available from Invitrogen (see page viii for … Return Document

SUPPLEMENTARY INFORMATION Hudlebusch Et Al., MMSET Is Highly …
proofreading HiFi Taq DNA polymerase (Invitrogen). Primer sequences including Gateway recombination sites were: Forward primer: 5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAATTTAGCATCAAGCAGAG-3’ … Retrieve Document

Utilization Of Microsatellite Polymorphism For …
Containing a reaction mixture with 1 buffer (Invitrogen), 2 mM MgCl 2, 0.2 mM each deoxynucleoside triphosphate, 200 nM each forward and reverse primers, and 0.2 U of proofreading Taq polymerase (Platinum, Invitrogen) were per- … Document Retrieval

Module 2 – taq polymerase Errors
Taq polymerase • DNA polymerasepurified from Thermus aquaticus a bacterium Examples of polymerases with proofreading activity • DyNAzyme™ EXT DNA Polymerase(FINNZYME) : error rate 6 x10 … Fetch Doc

Reverse Transcriptase – Wikipedia, The Free Encyclopedia
Lastly, RNA polymerase II transcribes the proviral DNA into RNA which will be packed into virions. Reverse transcriptase has a high error rate when transcribing RNA into DNA since, unlike any other DNA polymerases, it has no proofreading ability. … Read Article

Www.groco.is
Proofreading for fragments up to 1 Okb High Fidelity PCR for cloning and mutagenesis Platinum Pfx DNA Polymerase Invitrogen <1 2kb Blunt 100, 250, 500 rxns 1 1708-13 + + + + + + Routine PCR and yes/no sequence detection Accuprime Taq DNA polymerase … Retrieve Doc

Chris Wasden Joy Goldberg Nswers To Frequently Asked …
Invitrogen family. As Invitrogen, we will continue to provide you with the latest DNA polymerase or an enzyme mix composed of Taq DNA polymerase and a proofreading polymerase. … View Full Source