Pfu Taq Polymerase Stratagene

1 Biosynthesis Of Heparan Sulphate With Diverse Structures …
These purified products were amplified again by pfu taq polymerase (STRATAGENE) using 5’-primer with EcoRI site and 3’- primer with KpnI site. … Doc Retrieval

Shared Long-Range Regulatory Elements Coordinate Expression …
Cloning were done with high-fidelity Pfu Taq polymerase (Stratagene, CA). 43 ETS site targeting vector. To mutate the 43 enhancer, the left homol- … Read Content

P(acman): Recombineering Fly
PCR for homology arms (TAQ ONLY SHOULD BE FINE): Set up a gradient PCR (12 reactions, 44ºC to 66ºC) for each arm: Amplify preferably with Pfu (Stratagene), otherwise Taq polymerase (QIAGEN) or mix. … Access Doc

Manual: PfuUltra High-Fidelity DNA Polymerase AD
1 error per 2,500,000 bases, while Pfu DNA polymerase produces approximately 1 error per 770,000 bases and Taq DNA polymerase Try adding Stratagene Perfect Match PCR Enhancer to improve specificity. … Return Document

Pfu Taq Polymerase Stratagene Photos

Pfu DNA polymerase – Wikipedia, The Free Encyclopedia
Unlike Taq DNA polymerase, Pfu DNA polymerase possesses 3' to 5' exonuclease proofreading activity can also be used in conjunction with Taq polymerase to obtain the fidelity of Pfu with the speed of Taq polymerase activity. History. Scientists associated with the biotech company Stratagene, based in La … Read Article

In Vitro DNA Recombination By Random Priming
Min (Stratagene, La Jolla, CA). 8. 10X Taq PCR buffer: 100 m M Tris-HCl, pH 9.0, 50 m M KCl and 0.1% Triton X-100 (Promega, Madison, WI). 9. Cloned Pfu DNA polymerase (Stratagene, La Jolla, CA). … Retrieve Full Source

Human Monoclonal Antibody To Hepatitis C Virus E1 …
With Pfu Taq polymerase (Stratagene, La Jolla, Calif.) and HCV-specific oligonucleotide primers (forward, 5 -AGATCT TATGAAGTGCGCAACGTGTCCGGG; reverse 5 -CTGC … Fetch This Document

ROUTINE PCR REAGENTS TO MEET ANY BUDGET AMPLIFICATION – PCR …
Www.stratagene.com We invented the high-fidelity PCR market over a decade ago with the original Pfu DNA Polymerase. The EXL DNA polymerase is a special formulation of Pfu DNA polymerase, Taq DNA polymerase, and our … View Doc

PCR Amplification Introduces Errors Into Mononucleotide And …
(with 200 ng genomic DNA and 2.5 U Pfu DNA polymerase (Stratagene,Amsterdam,the polymerase Pfu in place of Taq restricted the occurrence of such errors only in the case of … Fetch This Document

Talk:Pfu DNA polymerase – Wikipedia, The Free Encyclopedia
Isn't Stratagene located in La Jolla, CA and not Jolly Rancher, the brand of candy? Pfu DNA polymerase is hence superior for techniques that require high-fidelity DNA synthesis, but can also be used in conjunction with Taq polymerase to obtain the fidelity of Pfu with the speed of Taq polymerase … Read Article

Cloning, Expression, And Characterization Of Thermostable DNA …
Was performed using 2.5 units of Pfu DNA polymerase (Stratagene, N. Torrey Pines Road, La Jolla, USA) in a 50µl reaction mixture, mutation frequency of Tay was compared to those of Taq and Pfu DNA polymerase. … View Full Source

14
Manufacturing of Pfu Native Pfu DNA Polymerase Stratagene introduced the first thermophilic proofreading polymerase Taq2000 DNA Polymerase Ultrapure cloned Taq that eliminates … Retrieve Doc