Hot Taq Polymerase Qiagen

Development Of A Cost-effective Pyrosequencing Approach For …
Each primer (Biolegio, AB Nijmegen, Netherland) and 0.5 U Taq FIREPol polymerase (Solis Biodyne). Taq DNA polymerase (Qiagen), FIREPol polymerase (Solis Biodyne) and When using a Hot-Start Taq FIREPol polymerase (Solis Biodyne), the PCR programme was modified by increasing the first … Fetch Document

Sixty-seven New Equine Microsatellite Loci Assigned To The …
The following reagents: 25 ng DNA, 1· PCR Buffer (Qiagen, Valencia, CA, USA), 1.5 mM MgCl 2,25lM each of dCTP, dGTP, and dTTP, 6.25 lM dATP, 0.125 lCi [a-32P] dATP, 0.45 U Hot Start Taq polymerase (Qiagen), and 5 pmol each primer. … Read Content

Ampdirect ® Plus Procedure
(Nova Taq. TM. Hot Start DNA Polymerase (EMD DNA Polymerase (QIAGEN GmbH)) cannot be used. —– PCR Condition using Nova Taq. TM. Hot Start DNA … Read Here

Thirty-five New Equine Microsatellite Loci Assigned To …
The following reagents: 25 ng DNA, 1· PCR Buffer (Qiagen, Valencia, CA, USA), 1.5 mM MgCl 2,25lM each of dCTP, dGTP, and dTTP, 6.25 lM dATP, 0.125 lCi [a-32P] dATP, 0.45 U Hot Start Taq polymerase (Qiagen), and 5 pmol each primer. … Access Content

D Et Ect Ion Of O PPortun Ist Ic Dna V Iral Inf Ect Ions BY …
Using 2.5 units of hot start Taq polymerase (Qiagen), 0.4mM dNTPs and 20 picomoles of primers each in a reaction volume of 50μl. Cocktail-3 (JC and BK) was performed using 3.5 units of hot start Taq polymerase (Qiagen), 0.4 … Content Retrieval

Ampdirect® Plus Procedure
*Most chemically modified versions of Taq DNA Polymerase [e.g. AmpliTaq Gold® (Applied Biosystems) and HotStartTaq® DNA Polymerase (QIAGEN GmbH)] can not be used. ・ PCR Condition using Nova TaqTM Hot Start DNA Polymerase … Access Full Source

EzWay™ Mouse Tail Direct PCR Kit – YouTube
Direct Hot Taq PCR MasterMix in this kit is a convenient mixture of Taq enzyme, dNTP, MgCl2 4:40 Watch Later Error Watch QIAGEN's unique PCR buffer in action by QIAGENvideos 4,389 views 4:38 Watch Later Error PCR Polymerase chain reaction by zabaaz 8,870 views … View Video

Taq polymerase – Wikipedia, The Free Encyclopedia
T. aquaticus is a bacterium that lives in hot springs and hydrothermal vents, and Taq polymerase was identified as an enzyme able to withstand the protein-denaturing conditions In December 1999, U.S. District Judge Vaughn Walker ruled that the 1990 patent involving Taq polymerase was issued, in part, on … Read Article

QuantiTect Green PCRHandbook
Achieved by the use of the hot-start enzyme, HotStarTaq DNA Polymerase, together with The QuantiTect SYBR Green PCR Master Mix contains HotStarTaq Polymerase, which is a modified form of QIAGEN Taq DNA Polymerase. … Read Content

Distribution, Growth, And Mortality Abstract Of Sailfish …
Using a QIAGEN DNeasy blood and tissue kit (QIAGEN #69506, Valencia, CA). A multiplex polymerase chain reaction (PCR) was performed by using an Eppendorf mastercycler gradient, QIAGEN Hot Star Taq DNA … View Doc

Hot Taq Polymerase Qiagen Photos

POLYMERASES & AMPLIFICATION
Taq PCR Kit contains a sufficient supply of recombinant, highly purified Taq DNA Polymerase, PCR-qualified buffer solutions, deoxynucleotides and a Try a hot start polymerase, such as OneTaq ™ Hot Start DNA Polymerase (NEB #M0481) .Primer annealing … Return Doc

Prenatal Diagnosis Of Alpha-Thalassemia Of Southeast Asian …
Primer S1 and S2 or S1 and S3, 1 U hot start Taq polymerase (Qiagen, Germany), and 5 µl of 10X buffer. Primer sets (L:CTGTCTTGTAACCTTGAT-ACC; R: TGAAGTCCAACTCCTAAGCCA) specif- … View This Document