Eppendorf Hotmaster Taq Polymerase

Eppendorf HotMaster—An Innovative Hot Start/Cold Stop …
The Y chromosome) was amplified using Eppendorf HotMaster Taq DNA polymerase. PRIMERS AND TEMPLATE: Forward Primer: CTCCGGAGAAGCTCTTCCTT Reverse Primer: CAGCTGCTTGCTGATCTCTG … Doc Viewer

DirectPCR Lysis Reagent (Tail)
Eppendorf Hotmaster Taq Polymerase (cat# 954-14-5018), Sigma JumpStart Taq DNA Polymerase (cat# D9307), or Qiagen HotStar Taq DNA polymerase (cat# 203203) is … Fetch Document

(Stratagene, La Jolla, CA, USA) End A- Strain Vector PUC19 …
The following experiments show that the eppendorf HotMaster ® Taq Polymerase can also be used quite effectively in Real Time PCR and can therefore be used in combination with the most modern PCR reagent and detection technologies. … Retrieve Full Source

Taq DNA Polymerase
Eppendorf® Buffer Pack 300 reactions* 0032 008.240 954 14 050-4 1000 reactions* 0032 008.259 954 14 052-1 HotMasterTaq DNA Polymerase 100 units 0032 002.676 954 14 015-6 … Fetch Doc

Efficient And Fast Amplification Of A Thymidine Kinase …
Promoter element using the Eppendorf Mastercycler® ep gradient S and HotMaster® Taq DNA Polymerase Dr. Yamagata, Tsukuba University, Japan Andrés Jarrin, Eppendorf AG … Retrieve Document

Improved Real Time PCR Applications Using Novel Eppendorf
The HotMaster Inhibitor Technology 5 Minutes Primer Extension with 2 U Taq DNA Polymerase with & without HotMaster Inhibitor Eppendorf RealMasterMix Probe Competitor´s qPCR master mix Ave r a g e C t +4oC -20oC -80oC … View Full Source

3, I 2, F 2002 OLUME SSUE ALL
Increased PCR Specificity and Sensitivity Using Eppendorf HotMasterTaq DNA Polymerase Page 4 Molecular Biology Reagents – It‘s All in the Testing … View Document

DirectPCR Lysis Reagent (Tail): Cat # 101-T, 102-T
Eppendorf Hotmaster Taq Polymerase (cat# 954-14-5018), Sigma JumpStart Taq DNA Polymerase (cat# D9307), or Qiagen HotStar Taq DNA polymerase (cat# 203203) is … Return Doc

A Genetic Analysis Of The Impact Of Generation Time And Road …
0.16 mM forward and reverse primer, 103 Eppendorf Hot-Master Taq Buffer (Eppendorf, Westbury, NY), and 0.75 units of Eppendorf Hotmaster Taq Polymerase (Eppendorf, … View This Document

Innovation Eppendorf PCR Premium Products
Reliable routine PCR Eppendorf® Taq DNA Polymerase StartPCR HotMaster™Hot Taq DNAPolymerase Difficult PCR / impure templates MasterTaq® Kit Eppendorf® MasterMix … Visit Document